RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - NDUFAF4

Gene ID	NCBI Gene 29078 \| KEGG hsa:29078
Gene Symbol	NDUFAF4
Protein Name	NADH:ubiquinone oxidoreductase complex assembly factor 4
Synonyms	C6orf66\|HRPAP20\|HSPC125\|MC1DN15\|My013\|bA22L21.1

Ortholog resource in our bank

  NDUFAF4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX035215	IRAK088A15	pCMV-SPORT6	BC039464	NM_014165	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR348975	RBb72H07	pGCAP1	NM_014165.1
HKR348975	GGTGCGGCCTGAACCTGAGCGCATAATGTTATGAGGAGATGGGAGCACTAGTGATTCGCG
HKR405887	RBdS014L23	pGCAP10	NM_014165.1
HKR405887	GACTTGTGCGCATGCTCCGGGTGTCCCGGAGTTGTCCTGCGCCGGTGTTCCCACGTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl