Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014L23

Clone ID RBdS014L23
HP ID HP06177
Gene ID 29078
Gene Symbol C6orf66
Protein Name chromosome 6 open reading frame 66
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014165.1
Length of RefSeq (bp) 725
Chromosome 6q16.1
Reference DDBJ accession
UniGene Hs.591333
5'-terminal sequence GACTTGTGCGCATGCTCCGGGTGTCCCGGAGTTGTCCTGCGCCGGTGTTCCCACGTGCGG
2011.08.28