Prev. |  KEGG KO K11883 > 

RIKEN DNA Bank Human Resource - NOB1

Gene ID NCBI Gene 28987 |  KEGG hsa:28987
Gene Symbol NOB1
Protein Name NIN1 (RPN12) binding protein 1 homolog
Synonyms ART-4|MST158|MSTP158|NOB1P|PSMD8BP1
Ortholog resource in our bank

  NOB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055836 IRAK139J20 pCMV-SPORT6 BC064630 NM_014062 Full
HGY083103 IRAL007M15 pOTB7 BC000050 NM_014062 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363673 RBd09D01 pGCAP10 NM_014062.1  
GACGCAGCCAACATGGCTCCAGTGGAGCACGTTGTGGCGGATGCTGGGGCTTTCCTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl