Prev. |  KEGG KO K07575 > 

RIKEN DNA Bank Human Resource - MCTS1

Gene ID NCBI Gene 28985 |  KEGG hsa:28985
Gene Symbol MCTS1
Protein Name MCTS1 re-initiation and release factor
Synonyms MCT-1|MCT1
Ortholog resource in our bank

  MCTS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082275 IRAL005L11 pOTB7 BC001013 NM_014060 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073322 ARe83F02 pKA1U5 NM_014060.1  
GGTCAGTGCCGGCCTTCCTCGTGTGAGGGGATCTGCCGGACCCCTGCAAATTCAATTTCT
HKR276593 ARiS191I01 pGCAP10 NM_014060.1  
GGGCTGGCTCTCGTTTTCCGGATAACGACTACAGCTCCGACTGTCAGTGCCGGCCTTCCT
HKR370548 RBd26G04 pGCAP10 NM_014060.1  
GTCCGGATAACGACTACAGCTCCGACTGTCAGTGCCGGCCTTCCTCGTGTGAGGGGATCT
HKR382549 RBd56G05 pGCAP10 NM_014060.1  
GCTTCCTCGTGTGAGGGGATCTGCCGGACCCCTGCAAATTCNNTTTNTTTCCCATTCCGG
HKR416058 RBdS040C10 pGCAP10 NM_014060.1  
GGACTGTCAGTGCCGGCCTTCCTCGTGTGAGGGGATCTGCCGGACCCCTGCAAATTCAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl