ARe83F02 NRCD Human cDNA Clone

Prev. | Human A to Z list > M > MCTS1 >

ARe83F02 - NRCD Human cDNA Clone


Catalog Number	HKR073322
Clone Name	ARe83F02
Clone info.	Plasmid clone of human MCTS1 cDNA with SV40 promoter
Vector⁽¹⁾	pKA1U5
5'-terminal sequence⁽²⁾	GGTCAGTGCCGGCCTTCCTCGTGTGAGGGGATCTGCCGGACCCCTGCAAATTCAATTTCT
Sequence, submitted⁽³⁾	n.a.
Sequence, refered	NM_014060.1 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	MCTS1 (NCBI Gene 28985) other clone of MCTS1 in our bank
Synonyms	MCT-1\|MCT1
Protein Name	MCTS1 re-initiation and release factor

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR073322	ARe83F02	DNA solution	JPY 9,460 plus cost of shipping containers, dry ice (if required) and shipping charge

How to cite this biological resource

Materials & Methods section:

The ARe83F02 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR073322).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.