Prev. | 

RIKEN DNA Bank Human Resource - C19orf53

Gene ID NCBI Gene 28974 |  KEGG hsa:28974
Gene Symbol C19orf53
Protein Name chromosome 19 open reading frame 53
Synonyms HSPC023|LYDG10
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162850 ARi07C02 pGCAP10 NM_014047.2  
GACAGTCCCGCCTCTTCCGCTGCGTGCCGGACCATGGCGCAGGGGCAGCGCAAGTTTCAG
HKR203210 ARiS008A10 pGCAP10 NM_014047.2  
GACAGTCCCGCCTCTTCCGCTGCGTGCCGGACCATGGCGCAGGGGCAGCGTAAGTTTCAG
HKR222037 ARiS055B13 pGCAP10 NM_014047.2  
TGGGACCTTGNNNCNNGGNCAGCNTATGTTNNAGGCGCACAANCCCGCANANAGTAANAC
HKR247526 ARiS118N14 pGCAP10 NM_014047.2  
GGAGGGTGGNTCCTGGGGACGAGCTAGGAGCGAGGGGATAGAGCCAGGGGCCGCGTTAGG
HKR331228 RBb28B04 pGCAP1 NM_014047.2  
GGGACCATGGCGCAGGGGCAGCGCAAGTTTCAGGCGCACAAACCCGCAAAGAGTAAGACG
HKR348450 RBb71C02 pGCAP1 NM_014047.2  
TCTCTTCCGCTGCGTGCCGGACCATGGCGCAGGGGCAGCGCAAGTTTCAGGCGCACAAAC
HKR416192 RBdS040H24 pGCAP10 NM_014047.2  
GGGACCATGGCGCAGGGGCAGCGCAAGTTTCAGGCGCACAAACCCGCAAAGAGTAAGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl