RBb28B04 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR331228 Clone Name RBb28B04 Clone info. Plasmid clone of human C19orf53 cDNA with SV40 promoter Vector Click for information pGCAP1 5'-terminal sequence(1) GGGACCATGGCGCAGGGGCAGCGCAAGTTTCAGGCGCACAAACCCGCAAAGAGTAAGACG Sequence, submitted(2) n.a.   Sequence, refered NM_014047.2 (NCBI RefSeq mRNA) Gene Symbol and ID(3) C19orf53 (NCBI Gene 28974)  other clone of C19orf53 in our bank Synonyms HSPC023|LYDG10 Protein Name chromosome 19 open reading frame 53

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2018.12.05