Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EIF3K

Gene ID (NCBI) 27335
Gene Symbol EIF3K
Protein Name eukaryotic translation initiation factor 3, subunit K
Synonyms EIF3-p28|EIF3S12|HSPC029|M9|MSTP001|PLAC-24|PLAC24|PRO1474|PTD001
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081604 IRAL004A04 pOTB7 BC001031 NM_013234 Full
HGY088880 IRAL022D08 pOTB7 BC007559 NM_013234 Full
HGY089798 IRAL024I06 pOTB7 BC007335 NM_013234 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR067231 ARe68B07 pKA1U5 NM_013234.2
GGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTGGA
HKR074170 ARe85H02 pKA1U5 NM_013234.2
GGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTGGAAGGCGACAGAAG
HKR235465 ARiS088L01 pGCAP10 NM_013234.2
GCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTG
HKR249032 ARiS122J16 pGCAP10 NM_013234.2
GCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTGGAAGGCGACAG
HKR277761 ARiS194G17 pGCAP10 NM_013234.2
GCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTG
HKR326426 RBb16B02 pKA1U5 NM_013234.2
GACCACCTCTTCCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAG
HKR375298 RBd38E02 pGCAP10 NM_013234.2
GCCACCACCTCTTCCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCC
HKR379204 RBd48A04 pGCAP10 NM_013234.2
GACCTCTTCCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCC
HKR379773 RBd49H05 pGCAP10 NM_013234.2
GGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTGGA
HKR342975 RBb57H07 pGCAP1 NM_013234.2
TGCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTGGAAGGCGACA
HKR430158 RBdS075G14 pGCAP10 NM_013234.2
GCTCTTCCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTG
HKR444008 RBdS110A08 pGCAP10 NM_013234.2
GCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl