Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110A08

Clone ID RBdS110A08
HP ID HP04537
Gene ID 27335
Gene Symbol EIF3K
Protein Name eukaryotic translation initiation factor 3, subunit K
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_013234.2
Length of RefSeq (bp) 910
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.314359
5'-terminal sequence GCTGTTCCCGTCCTTGAGGACGCCGTGCCGGGTCAGTGTTAGCCTCCAGCCCTGGTTGTG
2011.08.28