Prev. |  KEGG KO K12398 > 

RIKEN DNA Bank Human Resource - AP3M1

Gene ID NCBI Gene 26985 |  KEGG hsa:26985
Gene Symbol AP3M1
Protein Name adaptor related protein complex 3 subunit mu 1
Synonyms -
Featured content Lysosome (human)
Ortholog resource in our bank

  AP3M1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056360 IRAK140O24 pCMV-SPORT6 BC067127 NM_207012 Full
HGY095157 IRAL037O21 pDNR-LIB BC026232 NM_207012 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209312 ARiS023E16 pGCAP10 NM_012095.4  
GCTCGGCTTCTCCAGCTTCGGTAGGAGAGGATCCGGCGCCGAATCACTGACTGGCACAGG
HKR394175 RBd85H07 pGCAP10 NM_012095.4  
GGGCGCCGAATCACTGACTGGCACAGGTGTTGGGATAGTGTCTCACTTGGTCACCCAGGC
HKR405943 RBdS014O07 pGCAP10 NM_012095.4  
GATCCGGCGCCGAATCACTGACTGGCACAGGTGTTGGGAAAATGATCCACAGTCTATTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl