Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014O07

Clone ID RBdS014O07
HP ID HP07465
Gene ID 26985
Gene Symbol AP3M1
Protein Name adaptor-related protein complex 3, mu 1 subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_012095.4
Length of RefSeq (bp) 5144
Chromosome 10q22.2
Reference DDBJ accession
UniGene Hs.500104
5'-terminal sequence GATCCGGCGCCGAATCACTGACTGGCACAGGTGTTGGGAAAATGATCCACAGTCTATTTC
2011.08.28