Prev. |  KEGG KO K12493 > 

RIKEN DNA Bank Human Resource - ARFGAP3

Gene ID NCBI Gene 26286 |  KEGG hsa:26286
Gene Symbol ARFGAP3
Protein Name ADP ribosylation factor GTPase activating protein 3
Synonyms ARFGAP1
Featured content Endocytosis (human)
Ortholog resource in our bank

  ARFGAP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030169 IRAK075H01 pBluescriptR BC041383 NM_014570 Partial/var
HGY085886 IRAL014L22 pOTB7 BC005122 NM_014570 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007649 W01A019C01 pENTR-TOPO IRAL014L22 BC005122 NM_014570  
HGE007653 W01A019C05 pENTR-TOPO IRAL014L22 BC005122 NM_014570  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182451 ARi56C03 pGCAP10 NM_014570.4  
GGTCGCTCCTGCTGAGGCGGTAGCCGCTTTTCGTCGACTCTTACCGGTTGGCTGGGCCAG
HKR452917 RBdS132E21 pGCAP10 NM_014570.4  
GGCGGCTCACAGCTGACGATGGGGGACCCCAGCAAGCAGGACATCTTGACCATCTTCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl