Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132E21

Clone ID RBdS132E21
HP ID HP07609
Gene ID 26286
Gene Symbol ARFGAP3
Protein Name ADP-ribosylation factor GTPase activating protein 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014570.4
Length of RefSeq (bp) 2851
Chromosome 22q13.2-q13.3
Reference DDBJ accession
UniGene Hs.162877
5'-terminal sequence GGCGGCTCACAGCTGACGATGGGGGACCCCAGCAAGCAGGACATCTTGACCATCTTCAAG
2011.08.28