Prev. |  KEGG KO K01793 > 

RIKEN DNA Bank Human Resource - GLCE

Gene ID NCBI Gene 26035 |  KEGG hsa:26035
Gene Symbol GLCE
Protein Name glucuronic acid epimerase
Synonyms HSEPI
Ortholog resource in our bank

  GLCE

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095249 IRAL038C01 pDNR-LIB BC026096 NM_015554 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR432481 RBdS081D09 pGCAP10 NM_015554.1  
GGGCTCGGTCTCCCGGCTGCGCGCGGAGCGGGAGGGCTCTCCTCACACAAGCGCTTCCTT
HKR441971 RBdS104P11 pGCAP10 NM_015554.1  
GGGTGGCTCGGTCTCCCGGCTGCGCGCGGAGCGGGAGGGCTCTCCTCACACAAGCGCTTC
HKR442063 RBdS105C15 pGCAP10 NM_015554.1  
GGCGGGCACGGCGGTGGCTCGGTCTCCCGGCTGCGCGCGGAGCGGGAGGGCTCTCCTCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl