Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081D09

Clone ID RBdS081D09
HP ID HP09054
Gene ID 26035
Gene Symbol GLCE
Protein Name glucuronic acid epimerase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015554.1
Length of RefSeq (bp) 5043
Chromosome 15q23
Reference DDBJ accession
UniGene Hs.183006
5'-terminal sequence GGGCTCGGTCTCCCGGCTGCGCGCGGAGCGGGAGGGCTCTCCTCACACAAGCGCTTCCTT
2011.08.28