Prev. |  KEGG KO K16751 > 

RIKEN DNA Bank Human Resource - C2CD3

Gene ID NCBI Gene 26005 |  KEGG hsa:26005
Gene Symbol C2CD3
Protein Name C2 calcium dependent domain containing 3
Synonyms OFD14
Ortholog resources KEGG ortholog (KEGG orthology K16751) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027250 IRAK068C02 pCMV-SPORT6 BC035599 NM_015531 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE118035 M01C095B11 pDONR221 IMS11-C06 AK125894 ENST00000313681  
HGE118083 M01C095D11 pDONR221 IMS11-C06 AK125894 ENST00000313681  
HGE118131 M01C095F11 pDONR221 IMS11-C06 AK125894 ENST00000313681  
HGE118179 M01C095H11 pDONR221 IMS11-C06 AK125894 ENST00000313681  
HGE118227 M01C095J11 pDONR221 IMS11-C06 AK125894 ENST00000313681  
HGE118275 M01C095L11 pDONR221 IMS11-C06 AK125894 ENST00000313681  
HGE118323 M01C095N11 pDONR221 IMS11-C06 AK125894 ENST00000313681  
HGE118371 M01C095P11 pDONR221 IMS11-C06 AK125894 ENST00000313681  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180546 ARi51G02 pGCAP10 NM_015531.4 done
GAGGGCTGCCCAGCGGCGCCGGTTGCCGGGGAACGCAGGCGCCGTGGGGAGGGATGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl