Prev. |  Human A to Z list >  C >  C2CD3 > 

ARi51G02 - NRCD Human cDNA Clone

Catalog Number HKR180546
Clone Name ARi51G02
Clone info. Plasmid clone of human C2CD3 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GAGGGCTGCCCAGCGGCGCCGGTTGCCGGGGAACGCAGGCGCCGTGGGGAGGGATGGCGG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_015531.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) C2CD3 (NCBI Gene 26005)  other clone of C2CD3 in our bank
Synonyms OFD14
Protein Name C2 domain containing 3 centriole elongation regulator
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR180546 ARi51G02 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARi51G02a.seq   ARi51G02c.seq   ARi51G02.pdf

References and tips

Featured content

Reference


2021.08.05

NRCDhumcloneList_AR_210404.csv - GNP_filter3_NRCD_html_190131.pl