Prev. | 

RIKEN DNA Bank Human Resource - GORASP2

Gene ID NCBI Gene 26003 |  KEGG hsa:26003
Gene Symbol GORASP2
Protein Name golgi reassembly stacking protein 2
Synonyms GOLPH6|GRASP55|GRS2|p59
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087078 IRAL017L14 pOTB7 BC007770 NM_015530 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR370479 RBd26D07 pGCAP10 NM_015530.3  
CGGCCGGCCGATATCGTGTGGGGAGGATTAGAGCAGGCGGTGCGCTGGGGGCGGGAGCAG
HKR444098 RBdS110E02 pGCAP10 NM_015530.3  
GACCGATCGCCCGCCGCCATGGGCTCCTCGCAAAGCGTCGAGATCCCGGGCGGGGGCACC
HKR444237 RBdS110J21 pGCAP10 NM_015530.3  
GGGATTAGAGCAGGCGGTGCGCTGGGGGCGGGAGCAGCGCGGAGCCCGGCTCGGCCACAC
HKR474976 RBdS187H08 pGCAP10 NM_015530.3  
GGCGGAGCCCGGCTCGGCCACACCGATCGCCCGCCGCCATGGGCTCCTCGCAAAGCGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl