Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187H08

Clone ID RBdS187H08
HP ID HP07358
Gene ID 26003
Gene Symbol GORASP2
Protein Name golgi reassembly stacking protein 2, 55kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015530.3
Length of RefSeq (bp) 2504
Chromosome 2q31.1-q31.2
Reference DDBJ accession
UniGene Hs.431317
5'-terminal sequence GGCGGAGCCCGGCTCGGCCACACCGATCGCCCGCCGCCATGGGCTCCTCGCAAAGCGTCG
2011.08.28