Prev. |  KEGG KO K13706 > 

RIKEN DNA Bank Human Resource - ABHD14A

Gene ID NCBI Gene 25864 |  KEGG hsa:25864
Gene Symbol ABHD14A
Protein Name abhydrolase domain containing 14A
Synonyms DORZ1
Ortholog resource in our bank

  ABHD14A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081638 IRAL004B14 pOTB7 BC002571 NM_015407

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162130 ARi05F10 pGCAP10 NM_015407.3  
GGCAGGCGCGCCGAGATGGCCGCGCTCCTGGCCGCCTAGAGCCGGAGCGGCCCGCGGAGC
HKR475182 RBdS187P22 pGCAP10 NM_015407.3  
GGCAGGCGCGCCGAGATGGCCGCGCTCCTGGCCGCCTAGAGCCGGAGCGGCCCGCGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl