Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187P22

Clone ID RBdS187P22
HP ID HP04070
Gene ID 25864
Gene Symbol ABHD14A
Protein Name abhydrolase domain containing 14A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015407.3
Length of RefSeq (bp) 1093
Chromosome 3p21.1
Reference DDBJ accession
UniGene Hs.534400
5'-terminal sequence GGCAGGCGCGCCGAGATGGCCGCGCTCCTGGCCGCCTAGAGCCGGAGCGGCCCGCGGAGC
2011.08.28