Prev. | 

RIKEN DNA Bank Human Resource - ARMC8

Gene ID NCBI Gene 25852 |  KEGG hsa:25852
Gene Symbol ARMC8
Protein Name armadillo repeat containing 8
Synonyms GID5|HSPC056|S863-2|VID28
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005735 IRAK014F15 pCMV-SPORT6 BC013424 NM_213654 Full
HGX027835 IRAK069J19 pCMV-SPORT6 BC032661 NM_015396 Full/var
HGX033709 IRAK084E13 pCMV-SPORT6 BC041699 NM_015396 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243619 ARiS109A19 pGCAP10 NM_014154.2  
AAGATGGCNTGCTTGTTGGAGACCCCAATCCGCATGAGCGTCCTTTCGGAAGTAACAGCT
HKR331303 RBb28E07 pGCAP1 NM_014154.2  
TGAGGCTCAAGATGGCGTGCTTGTTGGAGACCCCAATCCNCATGAGCGTCCTTTCGGAAG
HKR474985 RBdS187H17 pGCAP10 NM_014154.2  
GAGGCTCAAGATGGCGTGCTTGTTGGAGACCCCAATCCGCATGAGCGTCCTTTCGGACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl