Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187H17

Clone ID RBdS187H17
HP ID HP05864
Gene ID 25852
Gene Symbol ARMC8
Protein Name armadillo repeat containing 8
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014154.2
Length of RefSeq (bp) 3232
Chromosome 3q22.3
Reference DDBJ accession
UniGene Hs.716404
5'-terminal sequence GAGGCTCAAGATGGCGTGCTTGTTGGAGACCCCAATCCGCATGAGCGTCCTTTCGGACCA
2011.08.28