Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATXN10

Gene ID (NCBI) 25814
Gene Symbol ATXN10
Protein Name ataxin 10
Synonyms E46L|HUMEEP|SCA10
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084326 IRAL010N14 pOTB7 BC007508 NM_013236 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043203 ARe08A03 pKA1U5 NM_013236.2  
GGCCGTCTCCTCCTCCCGCCTGAGGCGAGTCTGGGCTCAGCCTAGAGCTCTCCGGCGGCG
HKR054099 ARe35E03 pKA1U5 NM_013236.2  
GAGGCTCGACCCAGCTGTGAGCGGCAAGATGGCGGCNCCCAGGCCGCCGCCTGCCAGGCT
HKR062902 ARe57E06 pKA1U5 NM_013236.2  
GGCCGTCTCCTCCTCCCGCCTGAGGCGAGTCTGGGCTCAGCCTAGAGCTCTCCGGCGGCG
HKR071700 ARe79E04 pKA1U5 NM_013236.2  
GGCCGTCTCCTCCTCCCGCCTGAGGCGAGTCTGGGCTCAGCCTAGAGCTCTCCGGCGGCG
HKR203206 ARiS008A06 pGCAP10 NM_013236.2  
GGCCGTCTCCTCCTCCCGCCTGAGGCGAGTCTGGGCTCAGCCTAGAGCTCTCCGGCGGCG
HKR208234 ARiS020J18 pGCAP10 NM_013236.2  
GAGCCTAGAGCTCTCCGGCGGCGGCGCAGCTTCAGGGCAGCGCGGGCTGCAGCGGCGGCG
HKR219919 ARiS049N07 pGCAP10 NM_013236.2  
GGCCGTCTCCTCCTCCCGCCTGATGCGAGTCTGGGCTCAGCCTAGAGCTCTCCGGCGGCG
HKR235504 ARiS088M16 pGCAP10 NM_013236.2  
GCTGGGCTCAGCCTAGAGCTCTCCGGCGGCGGCGCAGCTTCAGGGCAGCGCGGGCTGCAG
HKR398011 RBd95A11 pGCAP10 NM_013236.2  
GAGGGCAGCGCGGGCTGCAGCGGCGGCGGCGGTTAGGGCTGTGTAGGGCGAGGCCTCCCC
HKR398499 RBd96E03 pGCAP10 NM_013236.2  
GGTCAGGCTCGACCCAGCTGTGAGCGGCAAGATGGCGGCGCCCAGGCCGCCGCCTGCCAG
HKR405571 RBdS013P11 pGCAP10 NM_013236.2  
GGCCGTCTCCTCCTCCCGCCTGAGGCGAGTCTGGGCTCAGCCTAGAGCTCTCCGGCGGCG
HKR406384 RBdS015P24 pGCAP10 NM_013236.2  
GAGCCTAGAGCTCTCCGGCGGCGGCGCAGCTTCAGGGCAGCGCGGGCTGCAGCGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.12

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl