Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015P24

Clone ID RBdS015P24
HP ID HP04743
Gene ID 25814
Gene Symbol ATXN10
Protein Name ataxin 10
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_013236.2
Length of RefSeq (bp) 2963
Chromosome 22q13.31
Reference DDBJ accession
UniGene Hs.475125
5'-terminal sequence GAGCCTAGAGCTCTCCGGCGGCGGCGCAGCTTCAGGGCAGCGCGGGCTGCAGCGGCGGCG
2011.08.28