Prev. | 

RIKEN DNA Bank Human Resource - WBP2

Gene ID NCBI Gene 23558 |  KEGG hsa:23558
Gene Symbol WBP2
Protein Name WW domain binding protein 2
Synonyms DFNB107|GRAMD6|WBP-2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004967 IRAK012G23 pCMV-SPORT6 BC010616 NM_012478 Full
HGY084048 IRAL010B24 pOTB7 BC007452 NM_012478 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041326 ARe03F06 pKA1U5 NM_012478.3  
ATTGCGTTTTGAGTCTCGGGACCCCTGTTTGGAGAGACTATGGCGCTCAACAAGAATCAC
HKR045228 ARe13B04 pKA1U5 NM_012478.3  
GGTTGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGATCGTCAA
HKR048434 ARe21B10 pKA1U5 NM_012478.3  
GGTTGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGATCGTCAA
HKR052179 ARe30H11 pKA1U5 NM_012478.3  
GATTGCGTTTTGAGTCTCGGGACCCCTGNTTGGAGAGACTATGGCGCTCAACAAGAATCA
HKR064827 ARe62B03 pKA1U5 NM_012478.3  
GACCCCTGNTTGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGA
HKR064836 ARe62B12 pKA1U5 NM_012478.3  
AGCTCATTGCGTTTTGAGTCTCGGGACCCCTGNTTGGAGAGACTATGGCGCTCAACAAGA
HKR174805 ARi37A05 pGCAP10 NM_012478.3  
GACCCCTGTTGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGAT
HKR182480 ARi56D08 pGCAP10 NM_012478.3  
GGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGATCGTCAATAA
HKR203566 ARiS008P06 pGCAP10 NM_012478.3  
GGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGATCGTCAATAA
HKR235355 ARiS088G11 pGCAP10 NM_012478.3  
GGAGTCTCGGGACCCCTGTTGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCG
HKR238529 ARiS096F09 pGCAP10 NM_012478.3  
GCCCCTGTTGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGATC
HKR324570 RBb11H02 pKA1U5 NM_012478.3  
HKR368979 RBd22H11 pGCAP10 NM_012478.3  
GACCCCTGTTGGAGAGACTATGGCGCTCAACAAGANTCACTCGGAGGGCGGCGGAGTGAT
HKR388180 RBd70H12 pGCAP10 NM_012478.3  
GGTTGGAGAGACTATGGCGCTCAACAAGAATCACTCGGAGGGCGGCGGAGTGATCGTCAA
HKR441661 RBdS104C13 pGCAP10 NM_012478.3  
GATTGCGTTTTGAGTCTCGGGACCCCTGTTGGAGAGACTATGGCGCTCAACAAGAATCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl