Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104C13

Clone ID RBdS104C13
HP ID HP10382
Gene ID 23558
Gene Symbol WBP2
Protein Name WW domain binding protein 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_012478.3
Length of RefSeq (bp) 1944
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.514489
5'-terminal sequence GATTGCGTTTTGAGTCTCGGGACCCCTGTTGGAGAGACTATGGCGCTCAACAAGAATCAC
2011.08.28