Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AGTPBP1

Gene ID (NCBI) 23287
Gene Symbol AGTPBP1
Protein Name ATP/GTP binding protein 1
Synonyms CCP1|NNA1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY053354 IRAK133G10 pBluescript BC060815 NM_015239 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR186402 ARi66A02 pGCAP10 NM_015239.2
GACAGGTTCCGCCGCCTCCAGCGCCGCCGCCGCAGCTGCCGCCGCCGCCGCCTCCGCCTC
HKR186476 ARi66D04 pGCAP10 NM_015239.2
GACAGGTTCCGCCGCCTCCAGCGCCGCCGCCGCAGCTGCCGCCGCCGCCGCCTCCGCCTC
HKR326852 RBb17C04 pKA1U5 NM_015239.2
GGCAGCTGCCGCCGCCGCCGCCTCCGCCTCGCCTGCCACCGGGGTTTGTATGAAAACACC
HKR462435 RBdS156B11 pGCAP10 NM_015239.2
GGCCGCCTCCAGCGCCGCCGCCGCAGCTGCCGCCGCCGCCGCCTCCGCCTCGCCTGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl