Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156B11

Clone ID RBdS156B11
HP ID HP05516
Gene ID 23287
Gene Symbol AGTPBP1
Protein Name ATP/GTP binding protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015239.2
Length of RefSeq (bp) 4436
Chromosome 9q21.33
Reference DDBJ accession
UniGene Hs.494321
5'-terminal sequence GGCCGCCTCCAGCGCCGCCGCCGCAGCTGCCGCCGCCGCCGCCTCCGCCTCGCCTGCCAC
2011.08.28