Prev. | 

RIKEN DNA Bank Human Resource - UBXN4

Gene ID NCBI Gene 23190 |  KEGG hsa:23190
Gene Symbol UBXN4
Protein Name UBX domain protein 4
Synonyms UBXD2|UBXDC1|erasin
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027984 IRAK069P24 pCMV-SPORT6 BC035594 NM_014607 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002074 W01A005D02 pENTR-TOPO IRAK069P24 BC035594 NM_014607  
HGE002076 W01A005D04 pENTR-TOPO IRAK069P24 BC035594 NM_014607  
HGE002078 W01A005D06 pENTR-TOPO IRAK069P24 BC035594 NM_014607  
HGE002080 W01A005D08 pENTR-TOPO IRAK069P24 BC035594 NM_014607  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR249153 ARiS122O17 pGCAP10 NM_014607.3  
GGGAGCCGGCTTCGGGACTGCGGAGACTACACACCGAGCGAGCGCCTGGGCCCGAAGGGA
HKR324946 RBb12G02 pKA1U5 NM_014607.3  
GGGAGCCGGCTTCGGGACTGCGGAGACTACACACCGTAGCGAGCGCCTGGGCCCGAAGGG
HKR328154 RBb20G10 pKA1U5 NM_014607.3  
GGAGGTGTTCTCGCGCGCGCTAGCGCGCGTCTCCCNTTTGCCGCTGACGGGCGTGCGCGC
HKR380132 RBd50F12 pGCAP10 NM_014607.3  
GAGCCAAGGTTGCGGGGGCCGCAGAGCCGGACGAAGACGGAGGGCGGAGCCGGCTTCGGG
HKR388473 RBd71D01 pGCAP10 NM_014607.3  
GGGGCGTGCGCGCTTGTGCGGAGCCGGAGGTGGGGGCCGAACCAGCCAAGGTTGCGGGGG
HKR391678 RBd79D06 pGCAP10 NM_014607.3  
GACACACCGAGCGAGCGCCTGGGCCCGAAGGGAGCGATGCTGTGGTTCCAGGGCGCCATT
HKR474997 RBdS187I05 pGCAP10 NM_014607.3  
GACACCGAGCGAGCGCCTGGGCCCGAAGGGAGCGATGCTGTGGTTCCAGGGCGCCATTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl