Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187I05

Clone ID RBdS187I05
HP ID HP05323
Gene ID 23190
Gene Symbol UBXN4
Protein Name UBX domain protein 4
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014607.3
Length of RefSeq (bp) 4018
Chromosome 2q21.3
Reference DDBJ accession
UniGene Hs.591242
5'-terminal sequence GACACCGAGCGAGCGCCTGGGCCCGAAGGGAGCGATGCTGTGGTTCCAGGGCGCCATTCC
2011.08.28