Prev. | Human A to Z list > K > 

RIKEN DNA Bank Human Resource - KANK1

Gene ID (NCBI) 23189
Gene Symbol KANK1
Protein Name KN motif and ankyrin repeat domains 1
Synonyms ANKRD15|CPSQ2|KANK
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010503 IRAK026E07 pCMV-SPORT6 BC020040 NM_153186 Partial
HGY029284 IRAK073D12 pBluescriptR BC038116 NM_153186 Full/var
HGY029468 IRAK073L04 pBluescriptR BC037495 NM_153186 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE090432 M01C026B08 pDONR221 MGC02-H04 BC038116 ENST00000382293
HGE090480 M01C026D08 pDONR221 MGC02-H04 BC038116 ENST00000382293
HGE090528 M01C026F08 pDONR221 MGC02-H04 BC038116 ENST00000382293
HGE090576 M01C026H08 pDONR221 MGC02-H04 BC038116 ENST00000382293
HGE090624 M01C026J08 pDONR221 MGC02-H04 BC038116 ENST00000382293
HGE090672 M01C026L08 pDONR221 MGC02-H04 BC038116 ENST00000382293
HGE090720 M01C026N08 pDONR221 MGC02-H04 BC038116 ENST00000382293
HGE090768 M01C026P08 pDONR221 MGC02-H04 BC038116 ENST00000382293

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR050150 ARe25G06 pKA1U5 NM_015158.2
GGAGTGGGCCCAAGCATCACACACGTGCTGGAGCTGAGTGTTCTCTGAGGAACATGCTAG
HKR209493 ARiS023M05 pGCAP10 NM_015158.2
GATCTTCCAGTGAGTACCAGCCTATTTGAGTGTAGGAAGGAGAAAAATCTGTGCTCCTGC
HKR362978 RBd07H10 pGCAP10 NM_015158.2
GCGGGTCCGCGGCGGAGCGAGCGAGCGGCCGGCAGGTTGGGAGGAGCGGCCGAAGGGTCT
HKR453074 RBdS132L10 pGCAP10 NM_015158.2
GGGGTCCGCGGCGGAGCGAGCGAGCGGCCGGCAGGTTGGGAGGAGCGGCCGAAGGTTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.06

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl