Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132L10

Clone ID RBdS132L10
HP ID HP04986
Gene ID 23189
Gene Symbol KANK1
Protein Name KN motif and ankyrin repeat domains 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015158.2
Length of RefSeq (bp) 5083
Chromosome 9p24.3
Reference DDBJ accession
UniGene Hs.306764
5'-terminal sequence GGGGTCCGCGGCGGAGCGAGCGAGCGGCCGGCAGGTTGGGAGGAGCGGCCGAAGGTTGAA
2011.08.28