Prev. |  KEGG KO K12875 > 

RIKEN DNA Bank Human Resource - ACIN1

Gene ID NCBI Gene 22985 |  KEGG hsa:22985
Gene Symbol ACIN1
Protein Name apoptotic chromatin condensation inducer 1
Synonyms ACINUS|ACN|fSAP152
Ortholog resource in our bank

  ACIN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027257 IRAK068C09 pCMV-SPORT6 BC032770 NM_014977 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046504 ARe16E08 pKA1U5 NM_014977.3  
GACAGGCTGCTGGGTAAGTGGCAAGATGGCTCCCCTTGCATGATCTCCGGCTGATCGCTG
HKR061251 ARe53C03 pKA1U5 NM_014977.3  
GGGCAAGATGGCTCCCCTGCATGTCTCCGGCTGATCGCTGCCGCTCCGCCAATACAATAG
HKR061773 ARe54H05 pKA1U5 NM_014977.3  
GGGNAAGATGGNTCCCCTGCNTGTCTNCGGCTGATCTGCATGNCGCTCCGACCAATACAN
HKR373756 RBd34G12 pGCAP10 NM_014977.3  
GGCTGGGTAAGTGGCAAGATGGCTCCCCTGCATGTCTCCGGCTGATCGCTGCCGCTCCGC
HKR430337 RBdS075O01 pGCAP10 NM_014977.3  
GGGGTAAGTGGCAAGATGGCTCCCCTGCATGTCTCCGGCTGATCGCTGCCGCTCCGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl