Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075O01

Clone ID RBdS075O01
HP ID HP04872
Gene ID 22985
Gene Symbol ACIN1
Protein Name apoptotic chromatin condensation inducer 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014977.3
Length of RefSeq (bp) 4951
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.124490
5'-terminal sequence GGGGTAAGTGGCAAGATGGCTCCCCTGCATGTCTCCGGCTGATCGCTGCCGCTCCGCCAA
2011.08.28