Prev. |  KEGG KO K17360 > 

RIKEN DNA Bank Human Resource - ACOT7

Gene ID NCBI Gene 11332 |  KEGG hsa:11332
Gene Symbol ACOT7
Protein Name acyl-CoA thioesterase 7
Synonyms ACH1|ACT|BACH|CTE-II|LACH|LACH1|hBACH
Ortholog resources KEGG ortholog (KEGG orthology K17360) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083008 IRAL007I16 pOTB7 BC017365 NM_007274 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164881 ARi12D09 pGCAP10 NM_007274.3  
GATTCATTCCGCGCCGGGCCTGCCAGACACCTGCGCCCTTCTGCAGCCGCCCGCCGCATC
HKR342826 RBb57B02 pGCAP1 NM_007274.3  
AAATGTGTGCGCCGGGCCTGCCAGACACCTGCGCCCTTCTGCAGCCGCCCGCCGCATCCG
HKR399609 RBd99A09 pGCAP10 NM_007274.3  
GACCTGCGCCCTTCTGCAGCCGCCCGCCGCATCCGCCGCCGCAGCCCCCAGCATGTCGGG
HKR428055 RBdS070C07 pGCAP10 NM_007274.3  
GATTCCGCGCCGGGCCTGCCAGACACCTGCGCCCTTCTGCAGCCGCCCGCCGCATCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl