Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070C07

Clone ID RBdS070C07
HP ID HP01776
Gene ID 11332
Gene Symbol ACOT7
Protein Name acyl-CoA thioesterase 7
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007274.3
Length of RefSeq (bp) 1814
Chromosome 1p36.31-p36.11
Reference DDBJ accession
UniGene Hs.126137
5'-terminal sequence GATTCCGCGCCGGGCCTGCCAGACACCTGCGCCCTTCTGCAGCCGCCCGCCGCATCCGCC
2011.08.28