Prev. |  KEGG KO K06691 > 

RIKEN DNA Bank Human Resource - ADRM1

Gene ID NCBI Gene 11047 |  KEGG hsa:11047
Gene Symbol ADRM1
Protein Name adhesion regulating molecule 1
Synonyms ARM-1|ARM1|GP110
Ortholog resource in our bank

  ADRM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005815 IRAK014I23 pCMV-SPORT6 BC010733 NM_175573 Partial
HGY095807 IRAL039I15 pOTB7 BC017245 NM_175573 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170929 ARi27F09 pGCAP10 NM_007002.2  
GGCCTCTCGAACGAGTGTGGGCGCGAGGCAGGATGACGACCTCAGGCGCGCTCTTTCCAA
HKR324549 RBb11G05 pKA1U5 NM_007002.2  
GCGGCGGGGCCCGGCAGGCGCCGAGGAGGAAGAGCGAGCCCGGACGGCGCCTCTCGAACG
HKR383276 RBd58D04 pGCAP10 NM_007002.2  
GAAGAGCGAGCCCGGACGGCGCCTCTCGAACGAGTGTGGGCNNNNNNNAGGATGACGACC
HKR430223 RBdS075J07 pGCAP10 NM_007002.2  
GGCGGGTTTCCGGCGGGGCCCGGCAGGCGCCGAGGAGGAAGAGCGAGCCCGGACGGCGCC
HKR432423 RBdS081A23 pGCAP10 NM_007002.2  
GGGGGCCCGGCAGGCGCCNAGGAGGAAGAGCGAGCCCGGACGGCGCCTCTCGAACGAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl