Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075J07

Clone ID RBdS075J07
HP ID HP02236
Gene ID 11047
Gene Symbol ADRM1
Protein Name adhesion regulating molecule 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007002.2
Length of RefSeq (bp) 1410
Chromosome 20q13.33
Reference DDBJ accession
UniGene Hs.90107
5'-terminal sequence GGCGGGTTTCCGGCGGGGCCCGGCAGGCGCCGAGGAGGAAGAGCGAGCCCGGACGGCGCC
2011.08.28