Prev. |  KEGG KO K09613 > 

RIKEN DNA Bank Human Resource - COPS5

Gene ID NCBI Gene 10987 |  KEGG hsa:10987
Gene Symbol COPS5
Protein Name COP9 signalosome subunit 5
Synonyms CSN5|JAB1|MOV-34|SGN5
Ortholog resources KEGG ortholog (KEGG orthology K09613) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089008 IRAL022I16 pOTB7 BC007272 NM_006837 Full
HGY082575 IRAL006H07 pOTB7 BC001187 NM_006837 Full
HGY084711 IRAL011M23 pOTB7 BC001859 NM_006837 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038542 W01A096F22 pENTR-TOPO IRAL006H07 BC001187 NM_006837  
HGE048159 W01A120G15 pENTR-TOPO IRAL006H07 BC001187 NM_006837  
HGE048167 W01A120G23 pENTR-TOPO IRAL006H07 BC001187 NM_006837  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056407 ARe41A07 pKA1U5 NM_006837.2  
GCTAGGTGTCATGGCTGCCCCAAGAGTCTAGGTAAGAGTTTGTTCCCGTGGTGCGGAGGG
HKR386476 RBd66D04 pGCAP10 NM_006837.2  
GATGGCTGCCCCAAGAGTCTAGGTAAGAGTTTGTTCCCGTGGTGCGGAGGGTCAAGGCCC
HKR402958 RBdS007G14 pGCAP10 NM_006837.2  
GAGGTGTCATGGCTGCCCCAAGAGTCTAGGTAAGAGTTTGTTCCCGTGGTGCGGAGGGTC
HKR430015 RBdS075A15 pGCAP10 NM_006837.2  
AAGGTCATGGCTGCCCCAAGAGTCTAGGTAAGAGTTTGTTCCCGTGGTGCGGAGGGTCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl