Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075A15

Clone ID RBdS075A15
HP ID HP04103
Gene ID 10987
Gene Symbol COPS5
Protein Name COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006837.2
Length of RefSeq (bp) 1510
Chromosome 8q13.2
Reference DDBJ accession
UniGene Hs.491912
5'-terminal sequence AAGGTCATGGCTGCCCCAAGAGTCTAGGTAAGAGTTTGTTCCCGTGGTGCGGAGGGTCAA
2011.08.28