Prev. | Human A to Z list > Y > 

RIKEN DNA Bank Human Resource - YWHAQ

Gene ID (NCBI) 10971
Gene Symbol YWHAQ
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta
Synonyms 14-3-3|1C5|HS1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Rb pathway
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16197)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX047933 IRAK119N21 pCMV-SPORT6 BC056867 NM_006826 Full
HGY082452 IRAL006C04 pOTB7 BC001197 NM_006826 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163702 ARi09E06 pGCAP10 NM_006826.2  
CGGCCGGCCGATTGAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCGCGTCGCGGCCGCG
HKR168002 ARi20A02 pGCAP10 NM_006826.2  
CGGCCGGCCGATTGAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCGCGTCGCGGCCGCG
HKR176128 ARi40F08 pGCAP10 NM_006826.2  
GGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGG
HKR182808 ARi57A08 pGCAP10 NM_006826.2  
TGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGG
HKR218278 ARiS045L14 pGCAP10 NM_006826.2  
GGGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCG
HKR260100 ARiS150E04 pGCAP10 NM_006826.2  
GGACACGGGAGGGTCCTCAGCTAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCGCGTCG
HKR260325 ARiS150N13 pGCAP10 NM_006826.2  
GCTCCGCCCCGGCCCCGGCCCCGCGCCCGCCATGGAGAAGACTGAGCTGATCCAGAAGGC
HKR321724 RBb04F04 pKA1U5 NM_006826.2  
GAGCTAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCTNCGTCGCGGCCGCGGAGACGTG
HKR322096 RBb05E01(TC) pKA1U5 NM_006826.2  
GCCCCGGCCCCGCGCCCGCCATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCG
HKR366522 RBd16F02 pGCAP10 NM_006826.2  
GAGATCAAAGTGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCT
HKR331379 RBb28H11 pGCAP1 NM_006826.2  
TGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGG
HKR379650 RBd49C02 pGCAP10 NM_006826.2  
GGCCGGGCGGAGGTGCCGCCCTTGAGAGCAGCCGGTTGTCGATGCCGCTCCCCTCAGGGA
HKR381731 RBd54F11 pGCAP10 NM_006826.2  
GACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGC
HKR382547 RBd56G03 pGCAP10 NM_006826.2  
GACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCNGCTGCGGGTCGGC
HKR382857 RBd57C09 pGCAP10 NM_006826.2  
GGTGGACCGCCCCTCGGCCCCGGGGTAGGCTGACACGGGAGGNNNCNCAGCTAAAGCCAA
HKR386482 RBd66D10 pGCAP10 NM_006826.2  
GGCTtccaTCTTGGGCCGGCCGGGCGGGGGTGGCGGGA
HKR387252 RBd68C04 pGCAP10 NM_006826.2  
GGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTC
HKR393227 RBd83B03 pGCAP10 NM_006826.2  
GACCCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGC
HKR394477 RBd86D05 pGCAP10 NM_006826.2  
GGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGG
HKR405354 RBdS013G10 pGCAP10 NM_006826.2  
GGGACTCGCGTCGCGNCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCG
HKR405840 RBdS014J24 pGCAP10 NM_006826.2  
TGTGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGT
HKR405848 RBdS014K08 pGCAP10 NM_006826.2  
GACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGC
HKR409057 RBdS022K17 pGCAP10 NM_006826.2  
GACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGC
HKR420731 RBdS051N19 pGCAP10 NM_006826.2  
GACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGC
HKR433289 RBdS083D17 pGCAP10 NM_006826.2  
GGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl