Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014J24

Clone ID RBdS014J24
HP ID HP00336
Gene ID 10971
Gene Symbol YWHAQ
Protein Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006826.2
Length of RefSeq (bp) 2166
Chromosome 2p25.1
Reference DDBJ accession
UniGene Hs.74405
5'-terminal sequence TGTGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGT
2011.08.28