Prev. |  KEGG KO K12398 > 

RIKEN DNA Bank Human Resource - AP3M2

Gene ID NCBI Gene 10947 |  KEGG hsa:10947
Gene Symbol AP3M2
Protein Name adaptor related protein complex 3 subunit mu 2
Synonyms AP47B|CLA20|P47B
Featured content Lysosome (human)
Ortholog resource in our bank

  AP3M2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035611 IRAK089A11 pCMV-SPORT6 BC056398 NM_006803 Full
HGY099344 IRAL048F24 pDNR-LIB BC056257 NM_006803 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234804 ARiS087A04 pGCAP10 NM_006803.3  
GGCGGGGCCTGTCCGCGCCTAGGAGCAGTGGGCGCTGAGAGCAGCAAGGCCAGAGTTGAA
HKR462442 RBdS156B18 pGCAP10 NM_006803.3  
GGGGCCCTGAGAGCAGCAAGGCCAGAGTTGAAAACTTACAGAGTCCTGAGGCTTTCAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl