Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156B18

Clone ID RBdS156B18
HP ID HP04485
Gene ID 10947
Gene Symbol AP3M2
Protein Name adaptor-related protein complex 3, mu 2 subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006803.3
Length of RefSeq (bp) 3624
Chromosome 8p11.2
Reference DDBJ accession
UniGene Hs.654529
5'-terminal sequence GGGGCCCTGAGAGCAGCAAGGCCAGAGTTGAAAACTTACAGAGTCCTGAGGCTTTCAGAC
2011.08.28