Prev. |  KEGG KO K10949 > 

RIKEN DNA Bank Human Resource - KDELR1

Gene ID NCBI Gene 10945 |  KEGG hsa:10945
Gene Symbol KDELR1
Protein Name KDEL endoplasmic reticulum protein retention receptor 1
Synonyms ERD2|ERD2.1|HDEL|PM23
Ortholog resources KEGG ortholog (KEGG orthology K10949) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084302 IRAL010M14 pOTB7 BC008958 NM_006801 Partial/var
HGY096261 IRAL040K21 pOTB7 BC018778 NM_006801

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167649 ARi19C01 pGCAP10 NM_006801.2  
GCTCCCTCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTCCCAAAG
HKR170880 ARi27D08 pGCAP10 NM_006801.2  
GCTCCCTCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTCCCAAAG
HKR344030 RBb60B06 pGCAP1 NM_006801.2  
GCCCCTCCCAAAGTCCCCTCCCCGGAGCGGAGCGCACCTAGGGTCCCTCTTCCGTCCCCC
HKR346482 RBb66D10 pGCAP1 NM_006801.2  
GCCTCCCTCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTCCCAAA
HKR346945 RBb67G01 pGCAP1 NM_006801.2  
TCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTCCCAAAGTCCCCT
HKR361353 RBd03G09 pGCAP10 NM_006801.2  
GGGGAGACCTCTCCCACCTCCTCGCCATCATCTTGCTACTGCTCAAAATCTGGAAGTCCC
HKR405531 RBdS013N19 pGCAP10 NM_006801.2  
GCTCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTCCCAAAGTCCC
HKR409085 RBdS022L21 pGCAP10 NM_006801.2  
GCCTCCCTCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTCCCAAA
HKR416003 RBdS040A03 pGCAP10 NM_006801.2  
GGCTCTCCTCCCTCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl