Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040A03

Clone ID RBdS040A03
HP ID HP00791
Gene ID 10945
Gene Symbol KDELR1
Protein Name KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006801.2
Length of RefSeq (bp) 1575
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.515515
5'-terminal sequence GGCTCTCCTCCCTCTTCCCGGCTCCAGCTCCGCCGCCAGCTCCAGCCTTTGCTCCCCCTC
2011.08.28