Prev. | 

RIKEN DNA Bank Human Resource - ARPP19

Gene ID NCBI Gene 10776 |  KEGG hsa:10776
Gene Symbol ARPP19
Protein Name cAMP regulated phosphoprotein 19
Synonyms ARPP-16|ARPP-19|ARPP16|ENSAL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001584 IRAK003P24 pCMV-SPORT6 BC003418 NM_006628 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045082 W01A112L18 pENTR-TOPO IRAK003P24 BC003418 NM_006628 done
HGE045084 W01A112L20 pENTR-TOPO IRAK003P24 BC003418 NM_006628  
HGE045086 W01A112L22 pENTR-TOPO IRAK003P24 BC003418 NM_006628  
HGE045088 W01A112L24 pENTR-TOPO IRAK003P24 BC003418 NM_006628  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052030 ARe30B06 pKA1U5 NM_006628.4  
GGGGCGGAGGCGGCCCGGCGGGCCCTGGGAGAGCTGGGACGGGCGGCGGCCGGGTGGCCT
HKR174002 ARi35A02 pGCAP10 NM_006628.4  
GGGAGGCGGCCCGGCGGGCCCTGGGAGAGCTGGGACGGGCGGCGGCCGGGTGGCCTCGGC
HKR238738 ARiS096O02 pGCAP10 NM_006628.4  
GGAANNNAAANANGAAGTGTTTNNACNANANCNAGCCNNAGANCCCTCNTCGAAGGGATT
HKR238760 ARiS096O24 pGCAP10 NM_006628.4  
GGGGCCCTGGGAGAGCTGGGACGGGCGGCGGCCGGGTGNNNTNNNNCATNANNTAATNGN
HKR342897 RBb57E01 pGCAP1 NM_006628.4  
GGCTCCGGCGCTGCGAGGGCCTTTGGCCAGCGGAAGCGATTTCGCGGCTTCCGNTGTTCG
HKR379370 RBd48H02 pGCAP10 NM_006628.4  
TGATAAGGCGGCGGCCATTTTCGCGGGCGGAGGCGGCCCGGCGGGCCCTGGGAGAGCTGG
HKR462683 RBdS156L19 pGCAP10 NM_006628.4  
GGCGGGCGGAGGCGGCCCGGCGGGCCCTGGGAGAGCTGGGACGGGCGGCGGCCGGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl