Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5L

Gene ID (NCBI) 10632
Gene Symbol ATP5L
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Synonyms ATP5JG
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY092512 IRAL031E16 pDNR-LIB BC015128 NM_006476 Full/var
HGY103102 IRAL057M14 pDNR-LIB BC070165 NM_006476 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR161210 ARi03A10 pGCAP10 NM_006476.4
GATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCCCAATTTGTC
HKR164128 ARi10F08 pGCAP10 NM_006476.4
GGGTCCTGCAGCGGGTCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGAC
HKR048453 ARe21C05 pKA1U5 NM_006476.4
GGTCCTGCAGCGGGTCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACT
HKR050501 ARe26E05 pKA1U5 NM_006476.4
GGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCC
HKR059632 ARe49B08 pKA1U5 NM_006476.4
GGGGTCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCA
HKR062499 ARe56E03 pKA1U5 NM_006476.4
GCTTCCGGCGGGTGACATTCAGCCGGCGGTTCCCCGNTGACGGACTCTCCATTCCAGAAC
HKR183605 ARi59A05 pGCAP10 NM_006476.4
GCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAAC
HKR065252 ARe63C04 pKA1U5 NM_006476.4
GGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCCCAATTT
HKR066404 ARe66A04 pKA1U5 NM_006476.4
GGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCCCAA
HKR066922 ARe67F02 pKA1U5 NM_006476.4
GGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCCCAA
HKR203345 ARiS008G01 pGCAP10 NM_006476.4
GGGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCCC
HKR208378 ARiS020P18 pGCAP10 NM_006476.4
GGGACTCTCCATTCCAGAACCATGGCCCAATTTGTCCGTAACCTTGTGGAGAAGACCCCG
HKR219803 ARiS049I11 pGCAP10 NM_006476.4
TGGGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCC
HKR362411 RBd06A11 pGCAP10 NM_006476.4
GCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACC
HKR330425 RBb26B01 pGCAP1 NM_006476.4
GCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAAC
HKR373300 RBd33E04 pGCAP10 NM_006476.4
GGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCCCAATTT
HKR382850 RBd57C02 pGCAP10 NM_006476.4
GAGCGGGTCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGNGNGACGGACTCTCCATT
HKR347657 RBb69C09 pGCAP1 NM_006476.4
TGGTCCTGCAGCGGGTCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGAC
HKR387636 RBd69B12 pGCAP10 NM_006476.4
GGGACTCTCCATTCCAGAACCATGGCCCAATTTGTCCGTAACCTTGTGGAGAAGACCCCG
HKR387678 RBd69D06 pGCAP10 NM_006476.4
GGCCTGACCTTGGAAGTGGGACGGGGTCCTGCAGCGGGTCCTTCCGGCGGGTGACATTCA
HKR398953 RBd97G09 pGCAP10 NM_006476.4
GGGACTCTCCATTCCAGAACCATGGCCCAATTTGTCCGTAACCTTGTGGAGAAGACCCCG
HKR420567 RBdS051G23 pGCAP10 NM_006476.4
GCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAAC
HKR433271 RBdS083C23 pGCAP10 NM_006476.4
GCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACC
HKR433457 RBdS083K17 pGCAP10 NM_006476.4
GCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATG
HKR441692 RBdS104D20 pGCAP10 NM_006476.4
GCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACC
HKR453003 RBdS132I11 pGCAP10 NM_006476.4
GCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAAC
HKR462686 RBdS156L22 pGCAP10 NM_006476.4
GCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAAC
HKR470813 RBdS177A13 pGCAP10 NM_006476.4
GGGGACGGGGTCCTGCAGCGGGTCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGC
HKR475169 RBdS187P09 pGCAP10 NM_006476.4
GGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl