Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156L22

Clone ID RBdS156L22
HP ID HP01302
Gene ID 10632
Gene Symbol ATP5L
Protein Name ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006476.4
Length of RefSeq (bp) 1343
Chromosome 11q23.3
Reference DDBJ accession
UniGene Hs.486360
5'-terminal sequence GCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAAC
2011.08.28